The most important feature of the PCR primers is specificity. Primers should hybridize exclusively to the genetic material of the IAPV and must not be complementary to the DNA of the close relative APV, which is very common in our region. There are already specific tests for the presence of the APV but up to now no genetic tests for the IAPV are developed.The primers have to fulfill the following criteria:

Specific for the genome of the IAPV

Both primers should have a similar annealing temperature (hybridization temperature of cDNA-primer)

Both primers should have a similar content in cytosine and guanine- bases. The CG-content determines the stability of the hydrogen bonds between cDNA and primer during the PCR

An important criterium is the length of the primer since this determines the price. Our primers should have about 20 to 25 bases.

The primers were designed for 3 different genomic segments of the virus. Database searches showed that especially these genes did not show a high homology between IAPV and APV.

The primer-design-team, consisting of 3 students, chose three primer pairs for each gene. Each student designed the primers for one IAPV - gene. The corresponding cDNA sequences were already published in the GenomeNet Database Service www.genome.jp.

The sequences were downloaded and used to feed an online primer design program of the Stanford Genomic Resources (http://seq.yeastgenome.org /cgi-bin/web-primer), which finally - after long and hard work - allowed us to find out specific primer pairs.

Originally, this tool was developed for baker´s yeast Saccharomyces cerevisiae, but since the genomic organization is similar in all creatures, the results can also be transferred to the virus IAPV.

Since the database does not consider that the primers must not hybridize to the genomic material of APV, this had to be checked manually.

This was a simple procedure: we just copied the APV sequence into MS word and searched for the primer sequences that were selected before.

To be on the safe side we used the forward as well as the reverse orientation and screened the whole APV genome. At last there remained one favourite primer pair per gene.

The results of the primer design were as follows:

Forward-Primer
CTGGCGATTCACAACAAGAA
Reverse-Primer
AAGCACCGTTGATGGTAATG

Forward-Primer - AATGCAAGTGAACGCTCCAA
Reverse-Primer - CCAATCATCTCCGTTTGCTA

Forward-Primer - GGTGTCCATTGGAACGAATGT
Reverse-Primer - CAAGGGTTTCAAATGCTTTAGC

Together with Dr. Nowotny from the University of Vienna our team tested the primer-pairs via PCR using positive controls obtained directly from Israel.